Activity
Quality analysis

During sequencing, errors are introduced, such as incorrect nucleotides being called. These are due to the technical limitations of each sequencing platform. Sequencing errors might bias the analysis and can lead to a misinterpretation of the data. Adapters may also be present if the reads are longer than the fragments sequenced and trimming these may improve the number of reads mapped. Sequence quality control is therefore an essential first step in any analysis.

Assessing the quality by hand would be too much work. That’s why tools like NanoPlot or FastQC are made, as they generate a summary and plots of the data statistics. NanoPlot is mainly used for long-read data, like ONT and PACBIO and FastQC for short read, like Illumina and Sanger.

Get sequencing reads

In this section, we'll download raw Illumina sequencing reads from the Sequence Read Archive (SRA) and explore their basic characteristics using Galaxy.

Accessing Galaxy

Open a web browser and go to usegalaxy.org If you don't have an account, create one by clicking on "Login or Register" at the top.

Figure

You should see something like this.

Downloading reads from SRA

In the Galaxy Tools panel on the left, click Get Data and select the "Download and extract reads in FASTQ format from NCBI SRA" tool.

Figure

This tool allows you to download available data from the SRA. Often, we are analyzing data mentioned in a publication that will provide you with an accession number either for the SRA or BioProject. For example, we can use the whole genome sequencing of Staphylococcus aureus at SRR14933407. Leave other options as default and click "Run Tool" in the top right. This will start downloading the raw reads in FASTQ format.

Tip

This will take a few minutes to run and the color will be Blanched Almond. (Yes, I looked up the name.)

Once the download is finished, you will see two green boxes:

• one for single-ended reads, and
• one for pair-ended reads.

Figure

Our SRA data only contains pair-ended reads, meaning we have forward and reverse reads from Illumina. If you click on the little information icon, Galaxy will show us job information.

Figure

Notably, it provides us the bash commands used for the job.

# Create accessions file
echo 'SRR14933407' | sed -r 's/(\,|\;|__cn__)/\n/g' > accessions

# Process each accession
for acc in $(cat ./accessions); do
    echo "Downloading accession: $acc..."

    # Download and extract fastq files
    prefetch -X 200000000 "$acc"
    fastq-dump --accession "$acc" \
               --split-files \
               --defline-seq '@$ac.$sn[_$rn]/$ri' \
               --defline-qual '+' \
               --split-spot \
               --gzip

    # Create output directory and move files
    mkdir -p output
    data=($(ls ./*.fast*))
    if [ ${\#data[@]} -eq 2 ]; then
        mv "${data[0]}" output/"${data[0]}"_forward.fastqsanger.gz
        mv "${data[1]}" output/"${data[1]}"_reverse.fastqsanger.gz
    elif [ ${\#data[@]} -eq 1 ]; then
        mv "${data[0]}" output/"${data[0]}"__single.fastqsanger.gz
    fi
done

echo "Done with all accessions."

You can see a preview of the raw reads by clicking on "Paired-end data" box, select SRR14933407, and then click on the visibility on either "forward" or "reverse". This will show you the first megabyte of the file, we only provide the first two forward-read sequences.

@SRR14933407.1/1
TGTAGGTGTTACAATCTTGCCAGAAATCATGATGAAAAATATCAGCAAAGAACAATTTGAGTTTGAAAAAGTAGAAATTGATAATGAACCGCTGATTCGTTCGACATTTATGAGTTATGATCCGAGTATGTTGCAATTACCACAAGTTGATTCATTTGTAAATCTTATGACGAGCTTTGTTGAAGAACCAAAGGCGTAGTCTTAGACTAATTTAAGGTTAGTATTTAATTTTAAAGATCGGAAGAGCACAC
+
DDDDDIIIHIIIIIIHIIIIHIIIGIIIIIIIIIIHHHIIIHIIIIIIHIHHIGFIIIIIIHHIIIIIIIIHHIIIIE<DFHHIIIHHIEHCHIIIIIIIHHHHIIHHIIIIFIIIIIIIIIIIIIIIIIIHIIIIIIIIIHIIIIHIIHIIHHIIIIIIIIIIHIIHHIIGIIGIHIHHHHGIIIIIIIIHIHIIIIIIIGIIHHIIIHIHHG@GHGCGHHHHIIIHHIIH?HGCEGH?EHHIHEHIFH@
@SRR14933407.2/1
CTAGAAATATTGATTTATTGCATGTATAATGTTAAAAGTGCCCTTTTATAACGCTTACATATAAAAGCTTATTTAGGGAGAGGGATATTCAACAAGGGGGATTTGAAAATGATAGAACTTAATGCAATTACAACATTATGTTTAGCCTGTATACTTTACTTACTTGGTAAAGCTATCGTTAATCACGTTAATTTTTTAAAACGCATTTGTATACCAGCACCAGTGATTGGTGGCTTAATCTTTGCTATTTT
+
DDDDAIIHIIHIHIHIIIIIIIIIIIIIIIIIIFGHIIIIIIFIIIIIIIIIIIIIIHIGHHIGHIIIEHIIIHIHHIDHHHGIIIIIIIIHIHHHFHHHCEHHIIIIGHCHHHHIIIIIIIIIHIIIIIIIIIHIHIIIIHIHIIIIIIHIHHHIIHIHIIIIIIHIIIIIIIHHHIIHIGHHHIIIIIIIIHIIIHIIIIIHHGIHIIFHHGEHIIHEHIIIIHICHHHHC??HHAGEEHHHEHHIIII

TODO: Contains the DNA read and the quality scores.

Running FastQC

Figure

Under "Raw read data from your current history", click the "Dataset collection" option, folder, select our "Paired-end data", and then hit "Run tool".

Figure

You will be given two collections of data on the right. We want to look at the "FastQC on collection 1: Webpage" forward and reverse. These reports contain a bunch of useful information, please read the FastQC report guide for explanations.